Lors de votre inscription suivez impérativement ces recommandations pour que votre compte soit validé.

Si vous voyez ce bandeau, c'est que vous n'êtes pas connecté. En cas de difficultés de connexion cliquez d’abord sur CE LIEN avant de cliquer sur “Connexion”

[Information] Phylogénie des araignées

Animateurs : MarcoBreizh, CedricMondy

Avatar du membre
vincesap
Membre confirmé
Enregistré le : samedi 30 avril 2011, 11:26
Localisation : Aube

[Information] Phylogénie des araignées

Message par vincesap »

Bonjour à tous. Ca va être un sujet un peu fourre-tout, dont je ne suis même pas certain de savoir quoi faire au final. Mais comme je me rends compte qu'il m'arrive de temps en temps de digresser, dans les sujets d'autrui ou les miens, sur la phylogénie des araignées, autant tout regrouper dans un même endroit. Ne serait-ce que pour arrêter de polluer les sujets des autres. Ce sujet est donc destiné à parler de la classification des araignées, de leur phylogénie, c'est-à-dire des relations des araignées entre elles. A terme, on peut envisager que ça donne lieu à un arbre phylogénétique des araignées, le projet m'intéresserait au plus haut point. Bien entendu, ce sujet ne m'est pas réservé, s'exprime qui veut (même si j'ai bien conscience que la phylogénie ne passionne pas les foules).

Bibliographie récupérée et à récupérer :

  • 1991 - Coddington JA, Levi HW - Systematics and evolution of spiders (Araneae) - Annual Review of Ecology and Systematics 22:565-592
  • 1991 - Platnick NI, Coddington JA, Forster RR, Griswold CE - Spinneret morphology and the phylogeny of haplogyne spiders (Araneae, Araneomorphae) - American Museum Novitates 3016: 1-73
  • 1995 - Hormiga G, Eberhard WG, Coddington JA - Web-construction behaviour in Australian Phonognatha and the phylogeny of nephiline and tetragnathid spiders (Araneae: Tetragnathidae) - Australian Journal of Zoology 43:313-364
  • 1997 - Scharff N, Coddington JA - A phylogenetic analysis of the orb-weaving spider family Araneidae (Arachnida, Araneae) - Zoological Journal of the Linnean Society 120:355-434
  • 1998 - Griswold CE, Coddington JA, Hormiga G, Scharff N - Phylogeny of the orb-web building spiders (Araneae, Orbiculariae: Deinopoidea, Araneoidea) - Zoological Journal of the Linnean Society 123(1):199
  • 1999 - Griswold CE, Coddington JA, Platnick NI, Forster RR - Towards a phylogeny ofentelegyne spiders (Araneae, Araneomorphae, Entelegynae) - Journal of Arachnology 27:53–63
  • 2000 - Ramírez MJ - Respiratory system morphology and the phylogeny of haplogyne spiders (Araneae, Araneomorphae) - Journal of Arachnology 28(2):149-157
  • 2003 - Silva-Davila D - Higher-level relationships of the spider family Ctenidae (Araneae: Ctenoidea) - Bulletin of the American Museum of Natural History 274: 1–86.
  • 2005 - Coddington JA - Phylogeny and classification of spiders - In: Ubick P, Paquin P, Cushing P, Roth V, eds. Spiders of North America: an identification manual. American Arachnological Society, 1824
  • 2005 - Griswold CE, Ramirez MJ, Coddington JA, Platnick NI - Atlas of phylogenetic data for entelegyne spiders (Araneae: Araneomorphae: Entelegynae) with comments on their phylogeny - Proceedings of the California Academy of Sciences 56(Suppl. II): 1-324
  • 2005 - Raven RJ, Stumkat KS - Revisions of Australian ground-hunting spiders: II. Zoropsidae (Lycosoidea: Araneae) - Memoirs of the Queensland Museum 50: 347-423
  • 2006 - Hedin M, Bond JE - Molecular phylogenetics of the spider infraorder Mygalomorphae using nuclear rRNA genes (18s and 28s): conflict and agreement with the current system of classification - Molecular Phylogenetics and Evolution 41(2):454-471
  • 2007 - Ayoub NA, Garb JE, Hedin M, Hayashi CY - Utility of the nuclear protein-coding gene, elongation factor-1 gamma (EF-1 [c]), for spider systematics, emphasizing family level relationships of tarantulas and their kin (Araneae: Mygalomorphae) - Molecular Phylogenetics and Evolution 42:394–409
  • 2008 - Benjamin SP, Dimitrov D, Gillespie RG, Hormiga - Family ties: molecular phylogeny of crab spiders (Araneae: Thomisidae) - Cladistics 24: 708-722
  • 2008 - Kuntner, M, Coddington JA, Hormiga G - Phylogeny of extant nephilid orb-weaving spiders (Araneae, Nephilidae): testing morphological and ethological homologies - Cladistics 24:147-217
  • 2008 - Rix MG, Harvey M, Roberts J - Molecular phylogenetics of the spider family Micropholcommatidae (Araneae: Araneae) using nuclear rRNA genes (18S and 28S) - Molecular Phylogenetics and Evolution 46:1031–1048
  • 2008 - Spagna JC, Gillespie RG - More data, fewer shifts: Molecular insights into the evolution of the spinning apparatus in non-orb-weaving spiders - Molecular Phylogenetics and Evolution 46(1):347-368
  • 2009 - Álvarez-Padilla F, Dimitrov D, Giribet G Hormiga G - Phylogenetic relationships of the spider family Tetragnathidae (Araneae, Araneoidea) based on morphological and DNA sequence data - Cladistics 25:109-146
  • 2009 - Blackledge TA, Scharff N, Coddington JA, Szüts T, Wenzel JW, Hayashi CY, Agnarsson I - Reconstructing web evolution and spider diversification in the molecular era - Proceedings of the National Academy of Sciences of the United States of America 106(13):5229-5234
  • 2009 - Muster C - Phylogenetic relationships within Philodromidae, with a taxonomic revision of Philodromus subgenus Artanes in the western Palearctic (Arachnida: Araneae) - Invertebrate Systematics 23: 135-169
  • 2010 - Crews SC, Gillespie RG - Molecular systematics of Selenops spiders (Araneae: Selenopidae) from North and Central America: implications for Caribbean biogeography - Biological Journal of the Linnean Society 101: 288–322
  • 2010 - Ledford JM, Griswold CE - A study of the subfamily Archoleptonetinae (Araneae, Leptonetidae) with a review of the morphology and relationships for the Leptonetidae - Zootaxa 2391:132
  • 2010 - Miller JA, Carmichael A, Ramírez MJ, Spagna JC, Haddad CR, Rezác M, Johannesen J, Král J, Wang X-P, Griswold CE - Phylogeny of entelegyne spiders: Affinities of the family Penestomidae (NEW RANK), generic phylogeny of Eresidae, and asymmetric rates of change in spinning organ evolution (Araneae, Araneoidea, Entelegynae) - Molecular Phylogenetics and Evolution 55(3):786-804
  • 2010a - Rix MG, Harvey, MS - The spider family Micropholcommatidae (Arachnida, Araneae, Araneoidea): a relimitation and revision at the generic level - ZooKeys 36:1-321
  • 2010 - Spagna JC, Crews SC, Gillespie RG - Patterns of habitat affinity and Austral/Holarctic parallelism in dictynoid spiders (Araneae:Entelegynae) - Invertebrate Systematics 24(3):238-257
  • 2011 - Dimitrov D, Hormiga G - An extraordinary new genus of spiders from Western Australia with an expanded hypothesis on the phylogeny of Tetragnathidae (Araneae) - Zoological Journal of the Linnean Society 161:735-768
  • 2011 - Lopardo L, Giribet G, Hormiga G - Morphology to the rescue: molecular data and the signal of morphological characters in combined phylogenetic analyses — a case study from mysmenid spiders (Araneae, Mysmenidae), with comments on the evolution of web architecture - Cladistics 27(3): 278-330
  • 2012 - Agnarsson I, Gregoric M, Blackledge TA, Kuntner M - The phylogenetic placement of Psechridae within Entelegynae and the convergent origin of orb-like spider webs - Journal of Zoological Systematics andEvolutionary Research 51:100-106
  • 2012 - Bond JE, Hendrixson BE, Hamilton CA, Hedin M - A reconsideration of the classification of the spider infraorder mygalomorphae (arachnida: Araneae) based on three nuclear genes and morphology - PLoS ONE 7(6):e38753
  • 2012 - Dimitrov D, Lopardo L, Giribet G, Arnedo MA, Alvarez-Padilla F, Hormiga G - Tangled in a sparse spider web: single origin of orb weavers and their spinning work unravelled by denser taxonomic sampling - Proceedings of the Royal Society B: Biological Sciences 279(1732):13411350
  • 2012 - Miller JA, Griswold CE, Scharff N, Řezáč M, Szüts T, Marhabaie M - The velvet spiders: an atlas of the Eresidae (Arachnida, Araneae) - ZooKeys 195: 1-144
  • 2012 - Griswold CE, Audisio T, Ledford JM - An extraordinary new family of spiders from caves in the Pacific Northwest (Araneae, Trogloraptoridae, new family) - ZooKeys 215: 77–102
  • 2012 - Wood HM, Griswold CE, Gillespie RG - Phylogenetic placement of pelican spiders (Archaeidae, Araneae), with insight into evolution of the "neck" and predatory behaviours of the superfamily Palpimanoidea - Cladistics 28: 598-626
  • 2013 - Agnarsson I, Coddington JA, Kuntner M - Systematics progress in the study of spider diversity and evolution - In: Penney D, ed. Spider research in the 21st century: trends and perspectives. Manchester: Siri Scientific Press, 58111
  • 2013 - Agnarsson I, Rayor LS - A molecular phylogeny of the Australian huntsman spiders (Sparassidae, Deleninae): implications for taxonomy and social behaviour - Molecular Phylogenetics and Evolution 69: 895-905
  • 2013 - Bayer S, Schönhofer AL - Phylogenetic relationships of the spider family Psechridae inferred from molecular data, with comments on the Lycosoidea (Arachnida: Araneae) - Invertebrate Systematics 27(1):53-80
  • 2013 - Bolzern A, Burckhardt D, Hänggi A - Phylogeny and taxonomy of European funnel-web spiders of the Tegenaria-Malthonica complex (Araneae: Agelenidae) based upon morphological and molecular data - Zoological Journal of the Linnean Society 168: 723-848
  • 2013 - Dimitrov D, Astrin JJ, Huber BA - Pholcid spider molecular systematics revisited, with new insights into the biogeography and the evolution of the group - Cladistics 29:132–146
  • 2013 - Kuntner M, Arnedo MA, Trontelj P, Lokovsek T, Agnarsson I - A molecular phylogeny of nephilid spiders: evolutionary history of a model lineage - Molecular Phylogenetics and Evolution 69:961-979
  • 2013 - Piacentini LN, Ramirez MJ, Silva D - Systematics of Cauquenia (Araneae: Zoropsidae), with comments on the patterns of evolution of cribellum and male tibial crack on Lycosoidea - Invertebrate Systematics 27: 567-577
  • 2014 - Bond JE, Garrison NL, Hamilton CA, Godwin RL, Hedin M, Agnarsson I - Phylogenomics resolves a spider backbone phylogeny and rejects a prevailing paradigm for orb web evolution - Current Biology 24(15):1765-1771
  • 2014 - Fernández R, Hormiga G, Giribet G - Phylogenomic analysis of spiders reveals nonmonophyly of orb weavers - Current Biology 24(15):1772-1777
  • 2014 - Maddison WP, Li DQ, Bodner M, Zhang JX, Xu X, Liu QQ, Liu FX - The deep phylogeny of jumping spiders (Araneae, Salticidae) - ZooKeys 440: 57-87
  • 2014 - Michalik P, Ramírez MJ - Evolutionary morphology of the male reproductive system, spermatozoa and seminal fluid of spiders (Araneae, Arachnida) - Current knowledge and future directions - Arthropod Structure & Development 43(4):291322
  • 2014 - Moradmand M, Schönhofer AL, Jäger P - Molecular phylogeny of the spider family Sparassidae with focus on the genus Eusparassus and notes on the RTA-clade and ‘Laterigradae’ - Molecular Phylogenetics and Evolution 74:48–65
  • 2014 - Ramírez MJ - The morphology and phylogeny of dionychan spiders (Araneae: Araneomorphae) - Bulletin of the American Museum of Natural History 390(1):1-374
  • 2015 - Gregorič M, Agnarsson I, Blackledge TA Kuntner M - Phylogenetic position and composition of Zygiellinae and Caerostris, with new insight into orb-web evolution and gigantism - Zoological Journal of the Linnean Society 175: 225-243
  • 2015 - Huckstorf K, Michalik P, Ramírez M, Wirkner CS - Evolutionary morphology of the hemolymph vascular system of basal araneomorph spiders (Araneae: Araneomorphae) - Arthropod Struct Dev. 44(6 Pt B):609-621
  • 2015 - Jocqué R, Henrard A - The new spider genus Palindroma, featuring a novel synapomorphy for the Zodariidae (Araneae) - European Journal of Taxonomy 152: 1-33
  • 2015 - Labarque FM, Soto EM, Ramirez MJ, Arnedo MA - Chasing ghosts: the phylogeny of Amaurobioidinae ghost spiders (Araneae, Anyphaenidae) - Zoologica Scripta 44(5): 550-561
  • 2015 - Lopardo L, Hormiga G - Out of the twilight zone: phylogeny and evolutionary morphology of the orb-weaving spider family Mysmenidae, with a focus on spinneret spigot morphology in symphytognathoids (Araneae, Araneoidea) - Zool. J. Linn. Soc. 173:527–786
  • 2015 - Maddison WP - A phylogenetic classification of jumping spiders (Araneae: Salticidae) - Journal of Arachnology 43(3): 231-292
  • 2015 - Polotow D, Carmichael A, Griswold CE - Total evidence analysis of the phylogenetic relationships of Lycosoidea spiders (Araneae, Entelegynae) - Invertebrate Systematics 29(2):124
  • 2015a - Xu X, Liu F, Chen J, Ono H, Li D, Kuntner M - A genus-level taxonomic review of primitively segmented spiders (Mesothelae, Liphistiidae) - Zookeys 21(488):121-151
  • 2015b - Xu X, Liu F, Cheng RC, Chen J, Xu X, Zhang Z, Ono H, Pham DS, Norma-Rashid Y, Arnedo MA, Kuntner M, Li D - Extant primitively segmented spiders have recently diversified from an ancient lineage - Proc. R. Soc. B 282: 20142486
  • 2016 - Garrison NL, Rodriguez J, Agnarsson I, Coddington JA, Griswold CE, Hamilton CA, Hedin M, Kocot KM, Ledford JM, Bond JE - Spider phylogenomics: untangling the Spider Tree of Life - PeerJ 4:e1719; DOI 10.7717/peerj.1719
  • 2016 - Hormiga G, Fernandez R, Kallal R, Ballesteros JA, Arnedo M, Dimitrov D, Giribet G - A phylogenomic approach to resolve the relationships among the main lineages of araneoid spiders - Denver Mus. Nat. Sci. Rep. 3:109–110
  • 2016 - Maddison WP, Maddison DR, Zhang JX, Szüts T - Phylogenetic placement of the unusual jumping spider Depreissia Lessert, and a new synapomorphy uniting Hisponinae and Salticinae (Araneae, Salticidae) - ZooKeys 549: 1-12
  • 2016 - Wheeler WC, Coddington JA, Crowley LM, Dimitrov D, Goloboff PA, Griswold CE, Hormiga G, Prendini L, Ramirez MJ, Sierwald P, Almeida-Silva L, Alvarez-Padilla F, Arnedo MA, Benavides Silva LR, Benjamin SP, Bond JE, Grismado CJ, Hasan E, Hedin M, Izquierdo MA, Labarque FM, Ledford J, Lopardo L, Maddison WP, Miller JA, Piacentini LN, Platnick NI, Polotow D, Silva-Dávila D, Scharff N, Szűts T, Ubick D, Vink CJ, Wood HM, Zhang J - The spider tree of life: phylogeny of Araneae based on target-gene analyses from an extensive taxon sampling - Cladistics ?
  • 2017 - Dimitrov D, Benavides LR, Arnedo MA, Giribet G, Griswold CE, Scharff N, Hormiga G - Rounding up the usual suspects: a standard target-gene approach for resolving the interfamilial phylogenetic relationships of ecribellate orb-weaving spiders with a new family-rank classification (Araneae, Araneoidea) - Cladistics 33: 221–250
  • 2018 - Fernàndez R, Kallal RJ, Dimitrov D, Ballisteros JA, Arnedo MA, Giribet G, Hormiga G - Phylogenomics, diversification dynamics, and comparative transcriptomics across the spider tree of life - Current Biology 28: 1489-1497
  • 2018 - Kallal RJ, Fernàndez R, Giribet G, Hormiga G - A phylostranscriptomic backbone of the orb-weaving spider family Araneidae (Arachnida, Araneae) supported by multiple methodological approaches - Molecular Phylogenetics and Evolution 126: 129-140
Modifié en dernier par vincesap le vendredi 15 mai 2020, 16:37, modifié 8 fois.
Vincent Valli dit Vince, collectionneur de taxons
=> 2000 le 21/06/20 (détail : icône site internet de mon profil)


On avance, pas toujours en ligne droite, mais on avance ! (olivier9099)
Avatar du membre
vincesap
Membre confirmé
Enregistré le : samedi 30 avril 2011, 11:26
Localisation : Aube

Phylogénie des araignées

Message par vincesap »

Et donc, le premier message, celui qui a été à l'origine de ce sujet, concerne la récente intégration des anciennes Nephilinae dans la nouvelle famille des Nephilidae.

J'ai parcouru l'article en question [Dimitrov, D., Benavides, L. R., Arnedo, M. A., Giribet, G., Griswold, C. E., Scharff, N. & Hormiga, G. (2017). Rounding up the usual suspects: a standard target-gene approach for resolving the interfamilial phylogenetic relationships of ecribellate orb-weaving spiders with a new family-rank classification (Araneae, Araneoidea). Cladistics 33(3): 221-250 & Suppl.], qui est vraiment magnifiquement documenté. L'échantillonnage utilisé est vraiment très important, avec un grand nombre de taxa qui ne sont jamais rentrés dans une étude de phylogénie. Le nombre de gènes est important lui aussi (7, c'est rare qu'on en voit autant !). Ce que j'apprécie particulièrement avec cet article, c'est qu'il fait le lien avec les données archéologiques, avec les structures des toiles (pour les familles orbitèles) et avec les synapomorphies des nouveaux classements, ce que les cladisticiens reprochent toujours aux phylogénéticiens de ne pas faire. Vraiment, les données semblent solides.

Et donc, pourquoi faire des Nephilidae une sous-famille d'Araneidae alors qu'on parle toujours de Nephilinae ? Tout simplement parce que dans "l'arbre" évolutif des aranéides sens large, les néphiles se retrouvent profondément ancrées "au milieu" des Araneidae. De fait, nos Zygiella seraient beaucoup plus proches des néphiles tropicales que des Araneus, Argiope et autres Gasteracantha. Vouloir absolument conserver le rang familial de Nephilidae aurait obligé à élever les genres Zygiella, Deliochus, Phonognatha et sûrement d'autres apparentés pour les mettre dans leur propre famille, ou de les inclure dans la famille des Nephilidae, ce qui a priori aurait eu moins de sens. Les auteurs précisent que la décision de repasser les néphiles dans les Araneidae n'est finalement qu'un retour aux sources : après tout, les néphiles étaient autrefois des Araneidae. D'ailleurs, la liste de Didier montre bien que les descriptions successives de cette espèces ont été faites dans des genres typiquement "aranéides" : Aranea, Epeira, Araneus.

Pour aller un petit peu plus loin, cette étude risque quand même de faire "coup-de-pied-dans-la-fourmilière" pour les sous-familles d'Araneidae. Car si l'on envisage de classer les sous-familles d'Araneidae dans la galerie, il faut se poser la question de savoir quelle sous-famille attacher à quel genre. Et, corollaire, quelle source utiliser, puisque le WSC ne considère pas les sous-familles. J'ai souvent le réflexe d'utiliser Wikispecies quand je cherche les sous-familles des araignées. Pour les genres Deliochus et Phonognatha, aucune sous-famille n'est donnée, ce qui a du sens : ça peut signifier que la sous-famille n'est pas tranchée, une sorte de classement insertae sedis, ce qui est cohérent avec leur rapprochement d'avec les néphiles. Par contre, pour les Zygiella, le site donne la sous-famille des Araneinae, ce qui n'a plus aucun sens avec ce nouvel arbre ! Il faudra sans doute refaire des études pour remettre de l'ordre dans tout ça, avec un échantillonnage concentré sur les Araneidae, mais si certaines sous-familles semblent bien définies (Nephilinae, Cyrtophorinae, Argiopinae), d'autres seront à revoir assez largement, notamment les Araneinae et les Gasteracanthinae (Cyclosa et Acanthepeira proches de Gasteracantha ; Caerostris faisant bande à part ; et groupe des Zygiella à définir).

Bref, comme je le disais, passionnant tout ça !!!
Vincent Valli dit Vince, collectionneur de taxons
=> 2000 le 21/06/20 (détail : icône site internet de mon profil)


On avance, pas toujours en ligne droite, mais on avance ! (olivier9099)
Avatar du membre
Pierre06
Membre confirmé
Enregistré le : vendredi 23 avril 2010, 18:45
Localisation : Cagnes-sur-Mer (06)

Phylogénie des araignées

Message par Pierre06 »

Je te lis et j'apprends. :wink:
... Pierre.
Avatar du membre
Dip
Admin-galerie
Enregistré le : mardi 5 septembre 2006, 21:52
Localisation : Alfortville, Val de Marne

Phylogénie des araignées

Message par Dip »

Oui, bien vu les anciens pour les Néphiles, mais celles-ci sont aussi passées chez les Tetragnathidae à ce dont je me souviens.
Ton dernier paragraphe résume ce que je voulais te dire à propos de ton désir d'inclure les sous-familles dans la Galerie. Je les introduis chez moi quand j'ai trop de bête à organiser, et cela a du bon, mais:
-- Les sous-familles sont bien fluctuantes,
-- Pas mal d'araignées ne sont pas classées, en dehors des familles des Aranéidés et des Salticidés.
Didier.
Avatar du membre
vincesap
Membre confirmé
Enregistré le : samedi 30 avril 2011, 11:26
Localisation : Aube

Phylogénie des araignées

Message par vincesap »

Merci Pierre :wink: .

Que toutes les familles d'araignées n'aient pas de subdivision en sous-famille n'est pas gênant en soi, c'est ainsi qu'est faite la classification. Ce qui est gênant par contre, c'est effectivement qu'au sein d'une famille qui utilise les sous-familles (par exemple les Araneidae), un certain nombre de genres ne s'en voit pas attribuer une. D'autre part, si pour les araignées on a la chance d'avoir le WSC qui fait référence, on n'a rien de tel pour les sous-familles. L'affaire s'annonce donc assez compliquée.

Il faut préciser que la cladistique et la phylogénie sont des sciences complexes, et qui reposent avant tout sur un aspect statistique. En cladistique, les différents caractères physiques sont évalués et "notés" pour chaque taxon étudié, les différentes notes sont comparées entre tous les taxons de l'étude, et un arbre est obtenu par des calculs mathématiques présageant de la plus grande probabilité de passer de tel type de caractère à un autre. Le problème est qu'en fonction des caractères physiques qui sont regardés, et en fonction des "notes" qui leur sont attribuées, les arbres peuvent changer. Pour la phylogénie, le principe de départ est le même, sauf qu'on compare les bases azotées constitutives des gènes. Ce procédé est réputé plus efficace que la cladistique (même si les cladisticiens disent le contraire...) puisque non seulement il s'affranchit des convergences évolutives (exemple TRES exagéré : si on utilise le caractère "acquisition du vol" dans les études, les insectes vont se retrouver juste à côté des oiseaux et des chauve-souris), mais en plus il permet d'évaluer des zones de gènes essentielles à la vie mais qui ne sont pas traduites en langage physique. Mais là encore, suivant les gènes que l'on va utiliser, on pourra avoir des abres différents.

Tout ça pour dire qu'au final, l'élaboration d'un arbre global ne peut pas se baser sur une seule étude, mais se fait en comparant un grand nombre d'entres elles, en mélangeant cladistique et phylogénie, en mélangeant de la phylogénie nucléaire et de la phylogénie mitochondriale, pour au final essayer d'accorder des indices de confiance sur tel groupe d'araignées qui sont très certainement parentes (qu'on les appelle Nephilidae ou Nephilinae, nul ne remet en question la validité de ce groupe), ou au contraire telles associations qui sont moins globalement acceptées. L'étude de Dimitrov et al. remet ainsi en question la validité des Orbiculariae, un groupe qui semblait plutôt bien admis jusque là.
Vincent Valli dit Vince, collectionneur de taxons
=> 2000 le 21/06/20 (détail : icône site internet de mon profil)


On avance, pas toujours en ligne droite, mais on avance ! (olivier9099)
LHommeInvisible
Membre confirmé
Enregistré le : jeudi 22 octobre 2015, 12:12
Localisation : Région Parisienne

Phylogénie des araignées

Message par LHommeInvisible »

Je me permets juste un commentaire Vincent, histoire de réctifier 1 ou 2 trucs :D :

la cladistique, les analyses sur le moléculaire, morphologiques touça touça... tout ça c'est de la phylogénie. :wink:

trois grandes écoles dans la phylogénie:
--> la cladistique, qui cherche l'arbre le plus parcimonieux à partir d'une matrice de caractères (morphologiques OU moléculaires, voire les deux), sans implémenter de modèle sinon d'éventuelles pondérations ou orientations des caractères.
--> la phénétique, basé sur une "distance globale" sans prendre en compte le caractère vraiment héréditaire des caractères; mais à l'origine la phénétique se targuait plus de classifier que de résumer l'histoire du vivant
--> les approches probabilistes (max de vraisemblance, inférence bayésienne...) dans lequel on estime à partir d'un modèle évolutif l'arbre le plus probable selon les paramètres donnés ou l'arbre obtenus par les paramètres les plus probables... approche plus généralement employée dès qu'il s'agit de données moléculaires (car c'est plus "simple" :roll: d'imaginer un modèle évolutif) mais qui n'exclue pas l'introduction de données morphologiques.

Par ailleurs, je ne suis pas expert en araignées, mais toute famille contient au moins une sous-famille, à savoir la sous-famille nominale (les Trucidae contiennent forcément les Trucinae ; et c'est vrai pour toutes les séries nominales, générique et spécifique); donc, si les auteurs du papier définissent les Nephilinae parmi les Araneidae sans autre forme de procès, cela voudrait dire qu'il y a deux familles, les Araneinae et Nephilinae. S'il est évident dans le papier que les Araneinae ne sont pas monophylétiques, et qu'ils n'ont pas défini d'autres sous-familles, c'est mal :wink: .
LHI,

ACTTGGATTTGTTGTATGAGCTCACCATATATTTACAGTAGGAATAGATGTTGACACT
Avatar du membre
vincesap
Membre confirmé
Enregistré le : samedi 30 avril 2011, 11:26
Localisation : Aube

Phylogénie des araignées

Message par vincesap »

Ah d'accord, je faisais effectivement l'amalgame en plusieurs notions : dans mon souvenir, la cladistique était réservée à la phylogénie morphologique, et l'approche probabiliste réservée à la phylogénie moléculaire (c'est en tout cas ce que je pensais avoir remarqué dans mes lectures d'articles). Quant à la phénétique, j'en ignore plus ou moins tout. Mon approche de la phylogénie des serpents remonte à 10 ans maintenant, il faut croire que mes souvenirs ne sont plus aussi précis que je l'espérais. Un grand merci donc de rafraichir tout cela, c'est bien utile. D'ailleurs, d'une façon générale, c'est très agréable d'avoir du répondant en face, ça va m'astreindre à ne pas dire n'importe quoi pour le seul plaisir de paraître intelligent :wink: .

Par contre, pour l'histoire des sous-familles, je ne suis pas tout à fait d'accord. La taxonomie moderne repose sur une certain nombre de rangs obligatoires (embranchement, classe, ordre, famille, genre, espèce ; je mets de côté le règne, dont le statut a été remis en question) et toutes leurs subdivisions possibles, mais qui elles ne sont pas obligatoires. Ainsi, si un embranchement devait n'héberger qu'une seule espèce, on parlerait quand même de la classe, de l'ordre, de la famille et du genre donnés à cette espèce. Mais rien n'obligerait les taxonomistes à lui donner une sous-famille. Après, je suis entièrement d'accord avec toi sur le côté intrinsèque de la sous-famille nominale : n'importe quelle famille des Bidulidae contiendra la famille des Bidulinae, mais qui elle-même contient la tribu des Bidulini, au sein de laquelle on peut encore intégrer la sous-tribu des Bidulina. De la même façon d'ailleurs qu'on peut s'amuser à intégrer cette famille dans la superfamille des Biduloidea. Mais tout ceci est intrinsèque. Ainsi, dire qu'il n'y a pas de sous-famille dans la famille des Oxyopidae par exemple ne me semble pas être un erreur. On pourrait dire plutôt qu'il n'y a pas de subdivision familiale, si on veut.

Quant à ton dernier paragraphe, je suis d'accord avec toi, l'article aurait mérité plus d'explications sur les sous-familles d'Araneidae. Il faudrait que je le relise en profondeur pour être certain de ne pas être passé à côté de quelque chose, mais à la décharge des auteurs, leur étude ne portait pas spécifiquement sur les Araneidae. Leur échantillonnage est conséquent (363 espèces séquencées dont 98 nouvelles !), mais concerne un grand nombre de familles : Eresidae, Deinopidae, Linyphiidae, Tetragnathidae, Uloboridae, Theridiidae, Theridiosomatidae, Nesticidae etc. Leur propos était beaucoup plus d'organiser les choses au sein des Orbiculariae que vraiment de s'intéresser spécifiquement aux Araneidae. Pour cette famille, leur échantillonnage est trop petit (32 espèces) pour pouvoir réellement certifier les relations subfamiliales. Ils auraient effectivement dû se contenter d'intégrer les néphiles dans la famille sans présager du rang qu'ils pourraient y occuper. Cela étant, la monophylie des anciennes Nephilidae semble ne faire aucun doute, il y a donc de fortes chances pour que les études suivantes, si elles confirment leur place au sein des Araneidae, confirme du même coup leur statut de sous-famille à part entière.
Vincent Valli dit Vince, collectionneur de taxons
=> 2000 le 21/06/20 (détail : icône site internet de mon profil)


On avance, pas toujours en ligne droite, mais on avance ! (olivier9099)
Avatar du membre
vincesap
Membre confirmé
Enregistré le : samedi 30 avril 2011, 11:26
Localisation : Aube

Phylogénie des araignées

Message par vincesap »

Comme Didier m'a fait me replonger dedans, je suis en train de me faire une banque de pdf pour essayer d'aborder la phylogénie générale des araignées. Le but ne serait bien sûr pas de faire un travail comparable à ce que peuvent pondre les phylogénéticiens de métier, mais de compiler leurs études les plus marquantes pour en sortir un arbre possible, voire probable, qui aurait des chances raisonnables de se rapprocher au maximum de la réalité. Est ce que c'est un projet qui pourrait t'intéresser ?
Vincent Valli dit Vince, collectionneur de taxons
=> 2000 le 21/06/20 (détail : icône site internet de mon profil)


On avance, pas toujours en ligne droite, mais on avance ! (olivier9099)
LHommeInvisible
Membre confirmé
Enregistré le : jeudi 22 octobre 2015, 12:12
Localisation : Région Parisienne

Phylogénie des araignées

Message par LHommeInvisible »

Ce que je voulais dire c'est que la sous-famille existe de facto lorsque la famille est créée (sans qu'elle soit explicitement décrite). Si on a la description des Grocloportidae Aligand, 2020 ( :roll: ), et qu'est ensuite décrite une sous-famille Encoreplugroinae Valli, 2023, on a automatiquement l'apparition du taxon des Grocloportinae Aligand, 2020... signifiant par là même qu'il existait dès la création de la famille (puisque la création d'un taxon de rang donné entraîne la création de toute la série nominale). En fait ça rejoint ce que tu dis.

Il faudrait que je jette un coup d'oeil sur ce papier à l'occasion. Les papiers auwquels participe Giribet sont souvent jolis, mais il a tendance à avoir de la donnée manquante!
LHI,

ACTTGGATTTGTTGTATGAGCTCACCATATATTTACAGTAGGAATAGATGTTGACACT
Avatar du membre
vincesap
Membre confirmé
Enregistré le : samedi 30 avril 2011, 11:26
Localisation : Aube

Phylogénie des araignées

Message par vincesap »

Oui, on est parfaitement d'accord. D'ailleurs, puisqu'on parle taxonomie générale, une bizarrerie qui m'a toujours hérissé le poil, chez les oiseaux. Anser anser, l'Oie Cendrée, espèce nominale de son genre, a priori espèce type de l'ordre des Anseriformes, se trouve pourtant dans la famille des Anatidae, dont le genre type est Anas. Je ne suis pas taxonomiste, mais je me suis toujours demandé pourquoi on n'avait pas soit les Anseriformes > Anseridae, soit les Anatiformes > Anatidae. Les actuelles lois de la taxonomie ne sont pas rétrospectives ?
Vincent Valli dit Vince, collectionneur de taxons
=> 2000 le 21/06/20 (détail : icône site internet de mon profil)


On avance, pas toujours en ligne droite, mais on avance ! (olivier9099)

Retourner vers « Araignées »